The next issue of Muse after one is about language and we’re running an article about a guy who invented a language called Tho Fan for a game called Jade Empire. We’d like to translate a short bit of something into Tho Fan as an example. Does anyone have any suggestions?
It has to be really short, like 200 words. Maybe something about language but maybe not puns which might blow a translator fuse. Something funny? Something pop? And as always we need it yesterday (actually by Friday the 10th). No Elizabethan.
–She Who Must Not Be Named (Sorry, don’t know how to flourish on computer.)
wow.
okay here it goes.
*deep breath*
Attention!
She Who Must Not Be Named has actually asked Musers to help her with the next issue of Muse. All Musers can participate and… Hey!!! *Kricket and Kitten but in*
Kitten- Why hello there!!! So how did you actually choose to pick us for this exciting wonderful… Ummm what would you call it, Kricket?
Kricket- I believe that it would be called an opportunity unlike any other.
Kitten- Ah, yes. Well, let’s get to it!!! Chop chop!!! get those Hot Pink Bunnies moving!!!
Kricket- Yes yes, it would be a pleasure to do this, thank you for inviting my dear friend Kitten and myself to help you with this wonderful issue of Muse.
She Who Must Not Be Named- But…
Kricket- Ah yes!!! we must pay tribute to She Who Must Not Be Named!!! Why thank you very much. Ta ta!!!
Kitten- yes we’ll be looking forward to the translation.
Of course, we’ll get our fee of course. When does that arrive?
She Who Must Not Be Named- What fee!!!!! This is supposed to be a opportunity not a business proposition!!!
Kricket and Kitten- What’s your point?
She Who Must Not Be Named- My point!!! Oh, never mind that.
Me and my friend invented our own language. We call it Nerdish and based off of Elvish. We can read, write, and speak it on command. Sometimes we just talk in Nerdish when we don’t want anyone to hear what we’re saying. I had to start a diary for English, and all my entries are written in Nerdish. As far as I know, only him and I can read, write, and speak it fluently. Two other people in my school are learning though. It’s fun.
P.S. I can also read and write in binary (the language of computers). You know, the long strings of 000010000001111110001010100101001001010010111100000101001
that flash on your computer when it’s turning on? I haven’t figured out how to speak it though…
Impressive. So, do you have a passage for the magazine to translate into Tho Fan?
I can count to ten in Welsh.
Un, dau, tri, pedwar, pump, chewch, saith, wyth, naw, deg.
And I can say some other things as well. And some Dutch. By the way, what does
000010000001111110001010100101001001010010111100000101001
actually mean?
And I can speak pi. Well, actually, I can recite the first, like, 100 digits.
Will we be able to read the passage in the mag if its written in Tho Fan? Will you write it in English too?
And, uh, Friday the Tenth is tomorrow! Couldn’t you have given us a little more time?
Well, you ruined the suprise of finding out what’s the focus of the next magizene, but if this means I get to help, yes. Okay here goes:
“He piled upon the whale’s white hump the sum of all the rage and hate felt by his whole race….If his chest had been a cannon, he would’ve shot his heart upon it.”
It is a quote from Moby Dick, which was used in Star Trek: First Contact. Those are both sweet books (and movies).
200 words? hmm…bit of an odd length isn’t it? too short or too long…
You could do a list of random quotes, that would be cool. Just go to the quotes thread and find stuff you like…
Or you could do something from an old issue-i mean like an ancient issue that hardly anybody’s read (yes, i’ll do anything to find out what’s in the back issues
lol)
OR you could do a dr. seuss book! That would be awesome! Yes yes! do a dr. seuss book!!! Please? (Note the l)
I vote dr. seuss book!!!
a friend and i learned egyptian heiroglyphics once….that was great fun….we couldn’t really speak it though…
i know some binary….
GAPA-what sort of passage?
You ruined the surprise! Curses! Ce ne c’est pas ma faute! Kawisrihr of the offending uyus will flow in rivers! I can speak French, some Spanish, Sindarin, Quenya, and German. I can write and read in Klingon, l33t and binary, but not speak these. And Tho Fan looks skiddy dense from my Google searches. OK, here’s my passage:
_______________________
“I am so cool you could keep a side of meat in me for a month! I am so hip I have difficulty seeing over my pelvis! I’m Kokopelli, man!”
________________________
Short and sweet. Pithy. A tribute to HG2G, which many readers will recognize, and also very froody, upbeat, Kokopellian, and a reference to that issue on self-esteem. Aren’t Musers hoopy?
I know there’s probably bunches of copyright issues, but it’d be cool if you could use part of the whale speech from The Hitchhiker’s Guide to the Galaxy. Or how about “The Walrus and the Carpenter”?
Take luck!
“In the beginning, there were the cats and the dogs. They lived a happy life, coexisting for many millenia, until suddenly, a reader of Muse wrote in requesting an article on one of them. The magazine was immediately swamped by requests for articles on cats, dogs, tenrecs, horses, and little happy fishes. Then, the all-great-and-powerful someone-or-another invented the Hot Pink Bunnies, and the magazine lived happily in peace ever after.”
Or you could use one of T.S. Eliot’s cat poems.
But then I suppose you’d have to find poems about dogs, tenrecs, Lord of the Rings, Harry Potter, hot pink bunnies, etc. to make everyone happy.
Yes! Language! awesome! Hmm… Let’s see. Quotes are a good idea.
“Only two things are infinite, the universe and human stupidity, and I’m not
sure about the former.”
– Albert Einstein (1879-1955)
“I’m all in favor of keeping dangerous weapons out of the hands of fools.
Let’s start with typewriters.”
– Frank Lloyd Wright (1868-1959)
“I find television very educating. Whenever someone turns on a set I go into another room and read a book.â€
-Groucho Marx
“There are 10 types of people in the world: those who understand binary and those who don’tâ€
-T-shirt
I can supply many more but there is a start.
maybe you can do an excerpt from h.p. lovecraft’s “call of cthulhu”
#4
I can recite about the first 20 odd didgets of pi!!
I learned it during pit band practice for the school play.
Performance tommoro
What is THO FAN???
Languages! I’m so excited!
I think I once wrote a letter requesting an article on them >.
heres my idea for a passage:
“If you can actually read this, then you spend too much time playing video games to learn a language from one. It’s just a video game, people! I mean, come on, does it really matter if you can read the piece of paper NPC #2 has in his hand when you see him for 5 seconds and he gets brutally slaughtered after you speak to him? Did you find the hidden easter egg? At Lord Lao’s Furnace, first pull on the Water Wheel, then move to the Cranking Cauldron and finally hit the Clapper Chimney. Finally, press the tiger button to change into the opposite gender. It’s temporary. Anyways, MUSE ROCKS and so do your lingual skills. Thank you for reading muse and have a nice day”
That’s my submission. Thank you so much for listening (the cheat is real)
Hello, this is the Musebloggers. She-Who-Must-Not-Be-Named has, strangly enough, asked us to write a paragraph to be included in an actual article in Muse. Apparently it is to be translated into Tho Fan, for the language issue. And she needs it tomorrow. And she’s not going to pay us. So don’t blame us about the poor, last-minute quality of our work. And also don’t blame us if it translates poorly into Tho Fan, because none of us know what the heck Tho Fan is, anyway. We think it might be short for Those Fans, which is obviously why we’re writing the spiffy paragraph. And we are not going to use this exalted honor to shamelessly promote our flamablamablous website, or to request articles on whatever-it-is-that-we-want-articles-on, or to point our that Pwt is neither a boy or a girl but a Gethenian. None of that. Instead, we’re going to talk about languages. Totally. Very briefly, because we are reaching our 200-word limit. Languages are cool. Bye.
~The Musebloggers
dang it, i miscounted by 20 words. hold on-let me revise.
Hello, this is the Musebloggers. She-Who-Must-Not-Be-Named has, strangely enough, asked us to write a paragraph to be included in an actual article in Muse. Apparently it is to be translated into Tho Fan, for the language issue. And she needs it tomorrow. And she’s not going to pay us. So don’t blame us about the poor, last-minute quality of our work. And also don’t blame us if it translates poorly into Tho Fan, because none of us know what the heck Tho Fan is, anyway. We think it might be short for Those Fans, which is obviously why we’re writing the spiffy paragraph. And we are not going to use this exalted honor to shamelessly promote our flamablamablous website, or to request articles on whatever-it-is-that-we-want-articles-on, or to point our that Pwt is neither a boy or a girl but a Gethenian. None of that. Instead, we’re going to talk about languages. Totally. Very briefly, because we are reaching our 200-word limit. Languages are cool. Especially Elvish. And all of those other languages that we like. Terribly useful things, languages. Um, Leet-speak is cool too. Bye.
~The Musebloggers
I like Em’s.
same. =D
Do something Roman. I like roman. Roman Roman Roman. See roman numeralls (up). Maybe on chariot races and gladiators. PLEEAAAaSSSSEEEEEE!!!
Thank you! Now where is SWMNBN?
oooh, darn, i passed the limit. oh well. and forgot to add about not being able to write in elizabethan. and about being to cheap to write something profound and innspiring to make it worth your while to translate this stupid paragrapgh anyway. i intended to mention these things, but never did. by the way, how is bob? he was a good friend of mine, you know.
Bob the hpb? Haven’t seen him…
speaking of pi, why not that poem where each word has the same number of letters as the digit of pi? that would be… pretty awesome… it was in a muse issue a while back.
Poe E., Near a Raven
One
A Poem
A Raven
Midnights so dreary, tired and weary,
Silently pondering volumes extolling all by-now obsolete lore.
During my rather long nap – the weirdest tap!
An ominous vibrating sound disturbing my chamber’s antedoor.
“This”, I whispered quietly, “I ignore”.
Perfectly, the intellect remembers: the ghostly fires, a glittering ember.
Inflamed by lightning’s outbursts, windows cast penumbras upon this floor.
Sorrowful, as one mistreated, unhappy thoughts I heeded:
That inimitable lesson in elegance – Lenore –
Is delighting, exciting…nevermore.
Ominously, curtains parted (my serenity outsmarted),
And fear overcame my being – the fear of “forevermore”.
Fearful foreboding abided, selfish sentiment confided,
As I said, “Methinks mysterious traveler knocks afore.
A man is visiting, of age threescore.”
Taking little time, briskly addressing something: “Sir,” (robustly)
“Tell what source originates clamorous noise afore?
Disturbing sleep unkindly, is it you a-tapping, so slyly?
Why, devil incarnate!–” Here completely unveiled I my antedoor–
Just darkness, I ascertained – nothing more.
While surrounded by darkness then, I persevered to clearly comprehend.
I perceived the weirdest dream…of everlasting “nevermores”.
Quite, quite, quick nocturnal doubts fled – such relief! – as my intellect said,
(Desiring, imagining still) that perchance the apparition was uttering a whispered “Lenore”.
This only, as evermore.
Silently, I reinforced, remaining anxious, quite scared, afraid,
While intrusive tap did then come thrice – O, so stronger than sounded afore.
“Surely” (said silently) “it was the banging, clanging window lattice.”
Glancing out, I quaked, upset by horrors hereinbefore,
Perceiving: a “nevermore”.
Completely disturbed, I said, “Utter, please, what prevails ahead.
Repose, relief, cessation, or but more dreary ‘nevermores’?”
The bird intruded thence – O, irritation ever since! –
Then sat on Pallas’ pallid bust, watching me (I sat not, therefore),
And stated “nevermores”.
Bemused by raven’s dissonance, my soul exclaimed, “I seek intelligence;
Explain thy purpose, or soon cease intoning forlorn ‘nevermores’!”
“Nevermores”, winged corvus proclaimed – thusly was a raven named?
Actually maintain a surname, upon Pluvious seashore?
I heard an oppressive “nevermore”.
My sentiments extremely pained, to perceive an utterance so plain,
Most interested, mystified, a meaning I hoped for.
“Surely,” said the raven’s watcher, “separate discourse is wiser.
Therefore, liberation I’ll obtain, retreating heretofore –
Eliminating all the ‘nevermores’ “.
Still, the detestable raven just remained, unmoving, on sculptured bust.
Always saying “never” (by a red chamber’s door).
A poor, tender heartache maven – a sorrowful bird – a raven!
O, I wished thoroughly, forthwith, that he’d fly heretofore.
Still sitting, he recited “nevermores”.
The raven’s dirge induced alarm – “nevermore” quite wearisome.
I meditated: “Might its utterances summarize of a calamity before?”
O, a sadness was manifest – a sorrowful cry of unrest;
“O,” I thought sincerely, “it’s a melancholy great – furthermore,
Removing doubt, this explains ‘nevermores’ “.
Seizing just that moment to sit – closely, carefully, advancing beside it,
Sinking down, intrigued, where velvet cushion lay afore.
A creature, midnight-black, watched there – it studied my soul, unawares.
Wherefore, explanations my insight entreated for.
Silently, I pondered the “nevermores”.
“Disentangle, nefarious bird! Disengage – I am disturbed!”
Intently its eye burned, raising the cry within my core.
“That delectable Lenore – whose velvet pillow this was, heretofore,
Departed thence, unsettling my consciousness therefore.
She’s returning – that maiden – aye, nevermore.”
Since, to me, that thought was madness, I renounced continuing sadness.
Continuing on, I soundly, adamantly forswore:
“Wretch,” (addressing blackbird only) “fly swiftly – emancipate me!”
“Respite, respite, detestable raven – and discharge me, I implore!”
A ghostly answer of: “nevermore”.
” ‘Tis a prophet? Wraith? Strange devil? Or the ultimate evil?”
“Answer, tempter-sent creature!”, I inquired, like before.
“Forlorn, though firmly undaunted, with ‘nevermores’ quite indoctrinated,
Is everything depressing, generating great sorrow evermore?
I am subdued!”, I then swore.
In answer, the raven turned – relentless distress it spurned.
“Comfort, surcease, quiet, silence!” – pleaded I for.
“Will my (abusive raven!) sorrows persist unabated?
Nevermore Lenore respondeth?”, adamantly I encored.
The appeal was ignored.
“O, satanic inferno’s denizen — go!”, I said boldly, standing then.
“Take henceforth loathsome “nevermores” – O, to an ugly Plutonian shore!
Let nary one expression, O bird, remain still here, replacing mirth.
Promptly leave and retreat!”, I resolutely swore.
Blackbird’s riposte: “nevermore”.
So he sitteth, observing always, perching ominously on these doorways.
Squatting on the stony bust so untroubled, O therefore.
Suffering stark raven’s conversings, so I am condemned, subserving,
To a nightmare cursed, containing miseries galore.
Thus henceforth, I’ll rise (from a darkness, a grave) — nevermore!
— Allanpoe, E.
Two
Change
My customary bedtime reading book hastily shelved, I sat, bewildered, pondering Allanpoe’s poetry.
“Something’s wrong”, I murmured. “Despite Ravenesque timbres, so mesmerizing (the echo
‘nevermore
nevermore
nevermore
nevermore
nevermore
nevermore
…’
survives, for example), my intellect detects wrongful alteration. This imitation, simulated Raven!…”
I recognized large, arbitrary changes. “Odd”, I thought. “Why?” To research, I headed downstairs, muttering softly, “Hmm”.
I hastened below carefully, there revisiting my book room. Books inhabited each table, shelf, and nook. Taking Cambridge Literature Treasury and proceeding to “Poetry, Poe’s”, my fears – oh my God! – heightened. Sighting no Raven but The Dark Bird, severe distress arose. “Absolutely, The Raven is maimed!”, I exclaimed. “How?!”
Immediately arriving upstairs, I posited a conspiracy: a literature alteration conspiracy. “Are,” I did quietly question, “all writings changed?”
Three
Of Carrolls
Jabwocky
Slithy toves, borogove
Gimbled there all out in strathwabe
Mimified and gyrified,
A rath is outergrabe.
“Beware a scrunch, a scratch, stepson!
Beware Jubjub, withstand a word!
Respect the Jabberwock and dread
Manxomian songbird!”
He, sword off hand, placement maintained
Thus to complete father’s grand quest –
Then waited, vaunting showily
His progenitor’s crest.
Therewith three swords he animized,
Before the creature, rumbling.
It was alive; its feelers straight
Burbled while whiffling!
The vorpall sword o’ vulcanite
Smote – snicker! snacker! – artfully
A headless Wocky residue
Yielded strength mournfully.
“Youth did it – O, praised fearlessness!”
He issued melodies, forthright.
“Death’s strike! O, day! Strallough! Stralleigh!” –
A-chortling in delight.
Borogove, strange slithy troves,
A brilligtime quickstep
Mimsy creatures, gimblified,
Frolicked on a steppe.
Four
An Hypothesis
I exhausted Carroll’s rewritten ode, Jabwocky, soliciting essential clues to fully explain my difficulty.
“A Heisenberg Twinge could have modified books’ contents thusly, but (my dubious thinking declared) surely these mutations are willed. I could sit and research a quantity of poetry’s excellent, famous passages, or try uncovering the structures.”
I therefore chose to scrutinize the words, and deliberate. I pondered games of alphabets, verses, language, sentences, equations, words. Lifting feather and inking it, my quill carefully scribbled thus:
A few schemata involving linguistical play
Lipograms: Writing so a letter’s missing
Haiku: An uncommon ode (poem) bearing eccentric metrification characteristics
A Cento: Quite strange poem; borrowed lines
Anagram: To turn an item (words) into a novel expression
Double-entendres: Words, dualistic sense
Palindrome: Forwards or backwards, words are not transformed (“Redraw, detooted warder!”)
A pangram: An amazing sentence, using whole alphabet
Acrostic: Inspected vertically, letters spell additional statement
Mnemonic: Can remember a factoid using this device
Pun: Groaner (“Stop, pundit!”)
Thus utilizing the plumelike pen, I hesitated.
“To cause these variations surely insinuates much diabolical, innovative ingenuity. My poetry’s clearly overturned; I cannot, however, rationalize. The [repeating] diabolical, innovative ingenuity! Although most beguiled, actually I’m near exhaustion. I am defeated, quite defeated, and undone!”, I yelled.
Truthfully, the eerie enigma was greatly intriguing. Reading afresh Raven’s discourses, I considered many options – a palindrome, a mnemonic, a conundrum.
“Full of mysteries, these poems crave observant review,” I announced. Thoughts involving rest stayed, however, slowly causing lethargy.
“Now,” (quietly said) “this sojourner will seek serenity. To bring sleep, the Musical Anthology usually renders help.” Turning to “Poetry, Anderson”, thus emerged a remarkable poem suggesting Jon’s musical group, Yes.
Five
Dreams
Many depths of accustomed
Workings controlled when dreams single electric life do touch
Assessing expression, future affection, ways yesterday
O, to yesterday
The day, a way, flying through someone
Controlled my reigning
Accepting evenings knowledge, a shout
To a revelation laid endings, talks by a flower
No yesterdays, heart faster alternate
Mutant leaves creativity
Of clay, understand doors reigning silhouette our skylines
A stone
Expression – a children’s – and being
Discoursing in lands, not put movement
Of hate – all expression creativity
The queen, those
Thousand answers sights done, understood, to mean changed
Love daughters
Memory come between all my antics
Did splendour I tell, a confusion endlessly?
We quickly as turned understood
Seed on turned
Mountains flowering of my sunrise, forgotten valley
Reasons together
Oh, all hands when highest
Touching a future way there’s thunderous oppression
Straining and work, a spirit’s
To a winter
Will I be, I regaining, returning, to this woman?
Outbound corner
Not I, apart yesterdays
You controlled my relayers, runner. I remember
My endlessly quickly soft mover
Night, night, deliver
Proportion spread running down forgotten coloured day rebounds
Watch loneliness
Arose ways satisfied from round
Thoughts consider touch preacher nailed daughters, as turned
Political regaining clear flower expressed
Understand rearrange, we dancing
We a foundation, morning, endlessly morning, while
Encounters searching
Not understand, my awakening
Hurry shoot out to transformed mutant
Enemy son, when here dislocate
Recorded chasers to battleship
In charger white begun returning moment loneliness
Is not seemed
From relayer’s silhouette charge
Liquid sweet girl disregard, conceived topographic endlessly
Strength mornings I consider the good; highest
Splendour reasons silence
Watch one space season glider, I’ll awaken
Regaining together
Silhouette amongst them, to lights
Stand more to stare, as watched begotten
There’s to begin solid, I remember
A madrigal; tell a marcher,
Touch wonder’s hand, there’s running my eclipses
Somewhere accustomed
Returning,
Awakens
Awakens
Awakens
Awakens
To stories wonderous
Six
Cadaeics
Conundrums, conundrums, conundrums…nonsense! I needed some outdoor atmosphere. Taking Cambridge’s Literature, I opened a door, waved my hand, commenced a promenade.
“I’m a Cadaeic!”
Huh?
“I’m a Cadaeic! I’m a real Cadaeic!”, shouted an old woman.
Astonished, I took a step back.
“A veritable Cadaeic, old woman? Really?” Cadaeics’ myths were numerous. A clique, a new mystic association, whose members had…power. An eerie power. So, I was now most curious. Still, staying calm, I placidly said, “Elucidate more, please.”
“Cadaeics have,” she murmured, “power. Do you?…”
“Yes, so I’ve intimated. Regardless, . . . Cadaeic? You apprehend this?” I said.
“Yes, sir. The true power lies greatly, heavily, within me.”
“What,” I softly inquired, “manner of power? A strength? telepathy? learning?”
“The power” (thusly continued that wizardly woman) “makes change in paralleled, tunneling universes. As I cultivate it, it is a powerful good, an element of great peace. Deplorably, he – Surta – uses it quite evilly, altering original Cadaeic intent.”
“Changes? A Cadaeic scoundrel generating wild mutations? This, though intriguing, I cannot quite see. This humble spirit requires validation – your narrative produces numerous doubts!”
“My apology, oh sir – I’m utterly desperate. A Cadaeic normally avoids ‘incapables’, enjoying other Cadaeic contacts only. Can, stranger, you befriend me? Cadaeic existence – indeed, people’s existence – demands prompt action.”
Startled, I then asked, “What? A pedestrian incapable’s worthless skill?”
“You, stranger, treasure the crucial analytic skills. Our people undervalue numerical ideas, preferring arcane, mystical, Cadaeified philosophy. Please help! Oh my Surta! O my Surta! Oh, lamentable Surta! O!”
I replied, “Yes, outlander, I’m available, amenable – also, somewhat numerical. Please, completely disclose:
When I am expected,
What assorted mathlike topics to review carefully,
plus
Where Surta’s mysterious home is.”
“Come, I recommend, before seven on tomorrow night (Michaelmas it is). Of a mathematic nature, review mensuration, infinite series, and trisection. Surta’s shadowy home? Meet me. Cadaeic fortress awaits.”
As my rendezvous was concluded, I meandered back, returning home.
“Quite impossible, what?”, thought I. “An old Cadaeic, a bad Cadaeic…mythical powers subverted, indeed!” Regardless, curiosity still stayed. The woman’s plea was serious, I concluded.
I desired an easement – perhaps more poetry. Opening Oxford’s volume near “Poetry, Eliot”, stanzas quite strange yet notorious filled my eyes. I saw Prufrock Lovesongs remarkably modified, thusly:
Seven
Prufrock
Let us depart then,
While eventide’s withering skies threaten,
Impersonating the sufferers etherising upon pallets;
Together henceforth go, through these partially-unoccupied boulevards,
Muttering arguments like shards
About furtive nights amid threadbare hostels,
Discreet dialogues among oystershells,
Street complexes like dreary argument.
Its insidious regiment
Now leads to heavy questions . . .
Never inquire distinctly, ‘wherefore?’
Directly go visit, herefore.
To an affair th’ matriarchs sadly go
To talk touching MicAngelo.
Mist, cellophane breaths, rubbing on window latches,
A creamlike mist, rubbing, muzzling on window lattices
Soon lingered on watery apartments a curt instant,
Licked eventide’s perimeter, tonguelike
(Partially discolored by fallen soot),
Vacillated a bit, making one extremely fast leap,
And, deeming that March night too remarkably quiet,
Stealthily curled womblike in quiescence, and fell perfectly asleep.
So, truly so, will exist a sundown
When amberlike fog permeates Cambridge Street
Above a door and a pane of doorglass;
Peaceful nighttimes darkening a boulevard,
Nighttimes whence faces verbalize to faces;
Nighttimes expedient for murders, or to intercommunicate;
Nighttime labors that create a query,
A query exalted, henceforth summarily despised.
Times touching you, touching anybody whom I appreciate.
Times involving several thousand hiatuses,
Forty illusions, forty revisions,
Finally settled by elegantly sipping green teas.
Matriarch speakers persevere [the discourses I forego],
A-talking about old MicAngelo.
So, cursedly, will remain eternity.
I can meditate: ‘To aspire? Evermore aspire?’
Mornings for mounting stairs,
Brushing uncovered spot in nervous, swarthy hair –
[I think she’ll certainly recognize a thinness!]
Stiff shirt, adamantly in place on chin,
Newly-purchased black tie, decorated using glamorous gold pin
[I conjecture he’ll pronounce forthwith: ‘Heavens! So frail! So thin!]
Should discreet adventures
Confound this earth?
Certainly eternity remains
To preside and deride, then turn around, reversing prior opinions.
Life advances, barely known –
The mornings, the bright middays, the nights of it.
My career is marked, poignantly, utilizing teaspoons;
I do know voices collapsing, sleepily collapsing, dying.
I do know the melodies emerging from the anterooms.
Henceforth, what ought I do?
Full well I did notice those eyes, everyone’s glaring stares –
So glaring, implying formulated phrases.
Afterward [quietly subdued] I, stick-pinned, embellish a wall;
Sit stuck, wriggling, alongside baroque designs.
Altogether hopelessly extinguished, wherefore should I assume?
Mournfully spitting lifetime’s butt-ends [a dreary existence],
What thoughts should thinkers think?
Truly known: discreet arms, jewelled arms,
Appendages slight and white and bare
[By th’ lamplights, covered up by an hairy gossamer]
Is hyacinth what provokes memories,
Causes such reveries?
I loved graceful arms, lying across davenports or wrapping about nightgowns
Should, henceforth, I assume?
Moreover, what to presume?
. . . . .
The noiseless dusk falls on my narrow streets
When lonely fellows settle, smoking pipettes,
Sacredly communing, shirt to shirt . . .
Oh, I can envision being as an empty claw
Scuttling violently about seas’ silent floors.
. . . . .
Thence unfolds an ominous property of the nighttime
Smoothed, having long hands,
Asleep . . . tired . . . lingering,
Easing comfortably beside you, while very serenely reposing beside me.
How, henceforth, after teapots, candies, ices,
Might lonely man’s forgotten strength reenergize, and arise?
Every afternoon I’ve fasted and wept – cried, fasted.
Ofttimes I dreamed, then saw my head surrendered to Herod;
I never approached prophet status, lamentably.
Though greatness came, quickly greatness went.
Often I recognized eternity’s hooded being, patiently biding, snickering.
Aftermath: fear perseveres.
So would it be valuable, valuable overall
Following saucers o’ marmalades
Admixing porcelain and a talk among window shades?
Therefore, I can wonder, valuable indeed?
Alarmed by an evermore-present need
Pressing universes into mysterious balls
Slowly unraveling a disturbing, ultrameaningful difficulty.
I’ll say: ‘Hallelujah! Lazarus’s return! I breathe, reanimate,
To entirely answer mankind’s conundrums’
Afterward, if matriarchs, settling quietly upon pillows,
Should derisively pronounce: ‘I despise meanings
My soul renounces all meanings.’
Would anything transpire worthwhile, everything appraised?
Mightn’t a time symbolize ‘worthwhile’,
Following dreary sunsets, plain dooryards, shopping carts on street
O’ the novels, after-lunch teas, lingering dresses –
Evermore a measured existence? –
It’s a so-difficult mission, enduring this struggle!
If a candle revealed my innermost yearnings
Exposing skeletons upon vertical screens
If an oldish woman, settling cushions,
Discarding day’s tattered, light-colored shawl, should aver:
‘Worthwhile? I know no moments worthwhile,
Just shadowy, dreaded voids after while.’
. . . . .
I, too, am not William Shakspar’s Hamlet – this I know, above a doubt.
Am one related lord, posing on the side
For acting very small acts or starting small episodes,
Most easy tool, Prince’s attentive slave,
Am always ready, obedient, useful,
Politic, cautious, of a meticulous frame;
Extravagant also, a bit dense;
Many moments I’ve fitly enacted the classical Fools.
I’m old . . . exceedingly old . . .
Soon my trouser I desire rolled.
A procession of contemplation – which marmalade flavor: raspberry? peach?
I’ll arouse up, and I will walk on Dartmouth Beach
To hear mermaids sing sublimely, and beseech.
I continue ignored, sorrowfully uninspired.
I have spied mermaid scales going fast underneath the waves,
Endlessly traversing an aquatic continent;
Wandering the high seas, capricious and content.
Thus we deliberate, oceanbound,
Looking for a harborside
Until mankind subsides.
Eight
The Readiness
Michaelmas. Waking up, I carefully pondered the baffling dilemma.
“Fact: vast changes unsettle alphabetic writings. Also, printed writings seem modified purposely (though possibly it’s not so). A fact: this woman (Cadaeic?) I saw recently, before eventide, bravely spoke a fantastic tale. She spoke concerning change also, and insinuated I’m a relation amid these two!”
I swallowed a breakfasty meal heartily, then gingerly I approached downstairs’ study for further linguistic review. I read poetry, employed statistics, parsed phrases. Near luncthime I modulated – as advised hitherto, I practiced mensuration, performed decimal expansion, and trisected triangles.
After my analytical labors, I read A Victorian Poetry Reader, The Book of Pastoral English Poets, Odes from Omar, Coleridge’s Heroic Poem, and Pindar’s Odes. “Still, I am not winning”, I lamented.
I ruminated: “Is a chapter division’s numbering important? Ignoring all elsewhere, I considered antepenultimate divisions. I succeeded there! Eureka! I codified a nice, simple formula which (I said to myself) “perfectly demonstrates the division’s pattern. Some somewhat different rule appertains elsewhere, apparently.”
Quickly I wondered: “Always this functions thus?” To see, I inspected longer antepenultimate pieces. Perfect agreement once again! No antecedent chapters functioned similarly, sadly.
I read poetry again, while hearkening to my clock – it was, I marked, dinnertime. Six literary booklets I collected (and, conjointly, a coat). On proceeding outwardly, the Cadaeic waited by a car.
“Quickly, neighbor, enter. Surta conspires – great danger awaits,” she declared.
Instantly her vehicle (holding unlikely mankind-protecting partners!) did accelerate and commenced travelling toward…somewhere. Driving purposely, my companion’s overall conduct was very somber. “Serious, is it?” I wondered.
To speak seemed an inapt stratagem, therefore nobody talked. “I think” (internally I said) “of a poem’s subtleties I’ll reconsider.” Thence appeared, transmuted, one quatrain that that eminent Persian – the tent-maker Omar – fashioned (as translated by Edward FitzGerald), hence:
Nine
O Ruby Yachts
Poetic Muses alongside th’ Bough
An oversupply o’ Wine, possessed somehow
Thou with me treading Eden’s Wilderness
Through all it seems a Paradise enough!
[Stanza twelve;
Translator: FitzGerald, Ed A.
3rd ed., 1872]
Ten
Clue
Completing poetical perusals, I restudied algorithms. “Perhaps,” I speculated, “some counting scheme?” The car, I noticed, had just paused near downtown’s Market Court. I then noted the miniature passageway which resided presently before us.
“Thence, neighbor, Surta awaits.”
A mysterious passageway stood there, entreating. Entering, I discovered Surta’s friend there.
“Promptly, proceed. Veritably, Surta’s inventing monstrous calamity.”
I walked the stone cobbles that covered the street and surveyed some ornamented doors. My guide uttered a word (magic?). Instantly I confronted an interior apartment – perhaps malevolent Surta’s room?
I then discovered innumerable mystifying artifacts therein:
A “Mr. Sardonicus” poster (Wm. Castler’s remarkable film)
Six heptagons containing six inscribed circles, drawn carefully below a weird finite-product formula
A large drawing showing horizontal striations with an underlined “sin (x¹²)”
Several computer prints involving triangles and angles
Accurately-reproduced picture of the Woolsthorp Manor House (Grantham, England)
Pieces for a strange “Snakes and Adder” children’s game.
So I observed hastily. “Yes, I am close,” I said. “Perhaps I am incredibly close now to resolving my dilemmas.” I perceived a bookcase in shadow. I repeated, “Surely, I am close!”. Infamous Surta’s shelves (all in a grand display) contained:
A Cambridge Treasury
Poe’s A Poem
Herbert’s Dune, Wyndham’s Triffids
Ad Infinitum & Beyond, Buzz Lite
Stories, Fitzgerald
Novels, Richardson
Aliceland, Lewis Carroll
Poems of England, Wordsworth
Oulipo Anthology, Perec
Several of my undeniable favorites I spotted among Surta’s shelves. Undoubtedly worthy choices!
In my wandering I discovered Shakspar’s Comedies & Dramas. “Hamletian inspection beckoneth!”, I joked. In restless expectancy, I located the final paragraphs.
Eleven
William Shakespeare’s tragedy King Claudius
[Fifth (terminal) Act]
. . . . So it is – deceased tanners a-populate the earth in multitudes. Wherefore? The skins are callously tanned! Here’s, gravely, th’ skull – O! – of a celebrated confrere.
HAM. Whose? Prithee, interpret.
A CLOWN. A mad fellow, foolhardy whoreson. Methinks he oftentimes frolicked i’ your path.
HAML. Ay, I frequently experience jovial company.
CLOWN. A pestilence ‘pon his head, stupid boaster! Doubtlessly oftentimes did ‘e brag: ‘I am Yorick, emperor o’ merrymakers!’
HAM. Behold, [Thrusting skullbone heavenward.]
wretched Yorick! Truly, Horaitio, truly I adored him – excellent banterer and a great wellspring o’ happiness. Thereon flourished a visage merry, a mouth pleasurably kissed, Horaitio. Where, I beseech, O head, are Yorick’s verses, gibes, gambols? Sounds o’ laughter tha’ caus’d a table great gaiety? Quite chapfallen? Perceive, Horaitio, this deathmask expression: merriment, merriment, evermore merriment!
Horaitio, three troubling questions confound me.
HOR. Disclose, prithee.
HAM. Thus look’d Cesar, as entombed?
HOR. Yes, I reckon.
HAM. Would great Alexander’s remains offend this nostril similarly? O! [Releases skull.]
HOR. Quite severely, assuredly.
HAM. So, is Caesar a dirtlike clump that remedies winecasks’ splits?
HOR. No, I say, no! Blasphemy, sir!
HAM. Understand, Horaitio – visualize mankind’s grave process. Originally, Caesar dies. In subsequent time, Caesar resides under th’ earth. Thereupon, celebrated Caesar’s decomposed. Forthwith, ‘e makes loam. Consider – a loam, a plaste! Might this overlord’s granules patch Horaitio’s beer-barrel?
A Caesar now becomes a sediment
Henceforth to toughen graveyard’s fundament;
Although a sovereign overrules with ire,
Henceforth, heartless, resembles th’ ashy mire!
[Retreats]
Twelve
The Meeting
Carefully replacing Shakspar’s Dramas in its shelf, I immediately heard a distant tapping. Anticipating Surta’s arrival, instead I saw my Cadaeic guide.
“Directly Surta will arrive,” she whispered. “Already I have ascertained several things. Every literary change that’s happened is, indeed, caused by Surta’s latest spell. I (actually, we, since I am quite unanalytical) must determine what change he’s effected exactly, and what (if anything) will reverse it. But silence! – Surta arrives.”
Fleeing quickly, my guide disappeared within an adjacent chamber. Evidently she maintained faith in my abilities – a faith that I didn’t necessarily share. Casting my gaze near Surta’s artifacts, I reassessed the clues present there. Each literary piece that I had studied flashed in my mind. Heuristic and mathematical schemes flickered in my brain.
I was interrupted by a stranger’s entrance.
“Greetings, stranger. I knew that she was disreputable, but I never imagined she’d enlist an incapable…” Clutching a paper sheaf, the middle-aged man snarled the final epithet. Being sure he was Surta, I (surprising myself) gave a defiant reply.
“Capable, I’d say,” I replied with sarcasm. “Huge literary changes were the first clue that the universe was amiss. Desecrated literature isn’t a small matter – thus, I’ll rectify the injustice,” I declared.
“Fie!” yelled Surta, suddenly. “But a single flaw in my skills has permitted this discernment. Fully the entire universe (a single being excepted, apparently) can’t even perceive the literary changes.”
Determining that I was near the right track, I pressed ahead.
“Certainly, indeed, several rules determine each printed text’s structure. Chapters besides the antepenultimate use a certain rule, and the antepenultimate uses a different rule.” Haughtily I said this, as if sure, even as uncertainty nagged at my brain.
Clearly my statement had an effect, as Surta was visibly surprised.
“B’Gah’s skull!” he hissed. “Getting a bit near the truth there, but still… I can’t be hindered by a mere lucky guesser. Even with luck, my secret will remain hidden!”
Jauntily, he remarked, “The literary effect can be reversed – in quite an elegant way, I must say – albeit certainly this will never happen. But simply write a text using precisely the same rules as mine and all will be mended. Hilarity ensues at the mere idea – what a time-waster! Ha, ha, ha!”, he cackled.
“Decidedly predictable, isn’t he?”, I said internally. “A big speech just like the classic villain’s I’m-invincible-thus-I-might-as-well-tell-the-secret spiel!” I had, it seemed, learned all I needed, except the exact rules determining a text’s structure. Given that I had already divined the antepenultimate-chapter rule, I was certain that, given time, I’d determine the remaining rules.
At that instant, my Cadaeic friend returned. Flashing me a significant glance, she entered in earnest debate with Surta. I sensed her cue and hurried exitward, stealthily grabbing the Shakspar’s Dramas as I left.
Cursedly, I remembered that we had entered rather magically. I didn’t have any idea where the exit was! I thus walked the hallways until I saw an uninhabited chamber. Camping there, I again began intense study, this time primarily in each text’s early chapters.
Giving A Midsummer Night’s Dream, the first play in the Shakspar reader, intense scrutiny, I suddenly saw it! “Electrifying!”, I exclaimed, as further study verified, at least tentatively, my belief.
A rumbling in the nearby wall suddenly caught my ear. Jackhammers! “Egress must be nearby,” I said quietly. Hunting left and right at eye level I quickly spied a crack. Behind it I saw the passageway we had walked a few minutes earlier. Jumping back, I ran firmly at the wall.
Gingerly picking myself up after my inelegant exit, I hurried back in expectancy, desiring the mathematical treatises residing in my study. During the next several days (as Surta’s writing rules were quite difficult, the task advanced quite gradually) I crafted a slim treatise – this very tale – that fulfilled the necessary requirements. I finished it five days after Michaelmas at three A.M.
Descending my stairs, I apprehensively checked my Cambridge Treasury. Despite my best attempts, mutated texts still met my eyes!
Evidently, I was still missing a key clue. I was sure that my main rule (describing all chapters but the antepenultimate) was right – it was very bizarre, thus it must be right, I argued. But a new idea appeared: as the antepenultimate rule I had crafted was relatively simple, perhaps there was an extra rule that applied as well?
Carl Sandburg’s Grass inhabited the antepenultimate chapter in the Cambridge Treasury. Just its few lines did I see, and study, thus:
Thirteen
Sandburg’s Grass
Caskets piled beneath Austerlitzes, Dresdens
As, silently uplifting, blanketing, grass
Disguises it all, it all.
And as fierce Gettysburg witnesses,
Evident at Champagne, Falklands, Jutland,
I am grassiness, settling ever thus.
But ten years passeth, and my guests plead:
Fury, military struggles, did mutilate us?
Ere yesterday, hatefulness prevailed?
Cut my grass.
Evergreen grasses mend.
Finale
The Victor
Though concise, the aforecited lines revealed new formal properties. Thus I came to discover a new symbolic paradigm. “It’s perfection now!”, my conviction did maintain.
My book requested alteration – not, luckily, broad revision. Following numerous fixes, my opus was perfect! “Good show!” I exulted cheerfully. My intuition philosophized: “Is textual change fully mended?” I examined Cambridge’s Anthology.
“Yes! Reality returns!”
. . . . .
Was this saga real? Apocryphal? Not believable? Perhaps. Regardless, Cadaeic foes remain, perchance to reciprocate or obliterate.
I celebrate.
I end, whispering ad infinitums.
THE END
If thats too long, just do The Raven part (one). And yes, thats ALL pi.
Yeah thats really long feel free to chop away at it!
Its 14 pages long in size 11 font! The whole thing is at
http://
Zap goes the link. But luckily we’ve got a lot of it (all of it?) in the previous post. — Rosanne
Whoh you didnt edit it! *send moderater virtual Choklit*
Holy. Zarquon. Singing. Fish. In. Triplicate. Jadestone, you have way too much time on your hands. But I read the whole thing, so there you have it. Nil combustibus profumo.
i was asking SWMNBN. remember, they’re married. ah, for th good old days. not that i was part of them. much. my ‘e’ ky is sticking. i am not going to bothr to rtyp all of those e’s that i just missd, just to prov my point. its not my bad spelling, peoples.
I think you should do something about Fast Food – about where they get their stuff (slaughterhouses, etc) and the diseases you can get. I’m really interested in stuff like that.
Ooooh yes…the happy union.
although i don’t think SWMNBN actually knows about her part…whoops…
Why not have two pages of the customary space filler “meet the Muses”, one in English and one in Tho Fan?
well, the deadline was today. i’m waiting to hear what they’ll use.
Unless they just keep us in suspense until April…
you are real, 100% cotton, you can wrinkle, accept that as a gift
Welcome, Kitty! (Only adults are allowed last names around here; I shortened yours assuming that you’re not one.) And thanks for the words of wisdom.
Ebeth, you’re obviously not a lurker anymore, so why don’t you go back to just being Ebeth? Or you could call yourself Ebeth the Former But Recently Rehabilitated Lurker.
Hello Kitty! Hello Clara! And Clara, I recommend reading Fast Food Nation by Eric Schlosser. It’s really good. I met Eric Schlosser at a food conference once a few years ago. He was really nice. He also likes Douglas Adams. (I was bored out of my skull and reading “Dirk Gently’s Holistic Detective Agency” at the time, and he came up to me, saw what I was reading, and talked energetically about D.A. for about twenty minutes. At which point I showed off my fanatical fandom. That’s my schnoozy anecdote for today.)
28- Yes, it is the whole thing. But i really didnt expect you to post it all so i put the link in.
30-Yes i do. And thank you for reading it.
Hmm…i’ll try it…
40-that’s cool!
But what were you doing at a food conference? What do you do in a food conference anyway? (besides eat?? do you eat?) oh well…
I’m really bored…
oh, that wouldn’t be very nice. we did write/suggest it. maybe they didn’t like any of our suggestions.
I Know!!! speak in DNA language: ATGC is the alphabet. AACTGATCTTGATTGCAAGATCTAGCGATCGA and so on. consider it! pleeez… I’ll cry if you don’t. like this:
sorry… that was kinda off subject wasn’t it? oops…
Ooh ooh!!! I have it I have it!!!!
(do this for the mag (if (please) you are still taking suggestions):
Chaos
One fine day in the middle of the night,
Two dead boys rose up to fight.
They stood back to back and faced each other,
Pulled out their swords then shot one another.
The deaf policeman heard the noise,
Pulled out his sword and killed the dead boys.
If you do not believe that this story is true,
Ask the blind man, he saw it too.
Anyway, I think that would be awesome.
Just me?
Gradster(1)
Cool. And that was in the- i can’t remember what issue. Oh well.
Kokopelic, that was a great one. I think they should use it! But maybe this one.
Ladies and gentlemen, bo-bos and chaps, flying mosquitos and bo legged ants. I come before you to stand behind you to tell you something I know nothing about. last night at exactly 6 pm in the morning an empty truckload of bricks rolled up our street and nearly killed my dead cat. we slowly rushed him to the hospital just in time to see Queen arthur sitting at the fourth corner of the round table yelling softly “As you all know, next tuesday is good friday. We will have a fathersday party for mothers only. Admition is free so pay at the door, pull up a chair and sit on the floor.”
I just thought it was cool. Let me know which one you liked better.
ebeth has never been a real actual lurker. first she was ‘ebeth’ then she was ‘the lurker’ then she was ‘ebeth the lurker’
Why? Hey, Ebeth the former but recently rehabilitated lurker, why?
No reason really. I do lurk a lot before i post, but besides that, lurking is..well…lurking. Like stalking. Except not. You linger, unseen, yet watching all…mwahahaha. It gives you excellent opportunities to practice your evil laugh too.
*sigh* well, i guess we won’t find out until the issue comes out.
#4
It is an offical greeting that can be translated to:
“Howdy Doody”
0110000010010010010001001000101100100000011110000000000000010011000000000000000101000011101011011011010000100000000000000101000010101000000000000000001000000000000000001100000000000001000100101010100000000001000100100011001010000010100101000000000000101011000000000001 reads
“Muse is an awesome mag!”
Yes, it has to be mag or you add 001010000010010100010001011100010 on the end.
I believe there’s something the mag needs to be translated into Chinese. If you have good handwriting and can speak and write Chinese, we need you! I’m not sure what it is, but I’ll find out.
bev.
u the one who can speak “nerdosh” (srry i forgot)
nyway if u are can u teach me(us)?
pwease!
pwease!
(oh wait… u wouldnt get that)oh well
47 is awesome
40
me too!
‘great book
DLOD- FORBIDDEN WORD ALERT! It’s almost as bad as *shudder* B-b-b-bb-B*****m!
just put all of Koko and Co. margin funnies in that language. Maybe the comic too, make it extend like in the LOTR issue.
I made up my own language. It is kind of hard to figure out, but it is fun to write. It basicly isn’t really a language- once you know what it is. For instance- in this language, “The cat has orange fur.”- would actualy be:”Eht tac sah egnaro ruf.” Does anyone know how to write it – now that you’ve seen it?
Doog-eyb
.rjhsif- sey, I od.
47- yes! great! just one correction
“If you dont beleive this LIE true
ask the blind man, he saw too”
I guess you could say story, but using lie makes it a bit more nonsensical.
Ti sekam tcefrep esnes oot em. *g*
Is there a Fishy Sr.? Or a Jr. Fishy Jr., like P.G. Wodehouse? I love the Wodehouse names-Eugenia Sprockett-Sprockett, Cyril Bassington-Bassington, Brancepeth Mulliner, Frederic Ickenham, Freddie Threepwood-I am naming my firstborn Dirk Svlad, but I might have to christen a fruit fly Brancepeth or something similar. Oh, P.G. Wodehouse, you reign supreme as a comedic nomeclature master.
56- Yes, I am fluent in Nerdish, although we (two of my friends, whose names shall be D-Man and Cuso-Man) have recently held an officail meeting and officailly changed the name to Solestic (Sol meaning Sun, so it would kind of mean the language spoken near the Sun). Anyway, D-Man and I can read and write perfectly, but are still mastering speech. Cuso-Man, Pepsi-Buyer, WrestlingMan, and Church_Guy are still getting down the reading and writing. Fellow NJHS member Cory still can’t even write his name. About teaching you, I could scan a copy of English-Solestic translation, but then it would be a picture, and you can’t post pictures on here. If you gave me your e-mail address, I could send it to you that way. Or address, and I could mail it. You see, D-Man and I are still looking into Making a new font for Microsoft Vista, which comes out September 2006, but we think it’s too late. So we either have to wait untill the even later version of Windows after Vista comes out, or we use some other, small business to write the program allowing us to type in Soestic, or we write the program ourselves. Then it still probably won’t work online. The keyboard is easy though, a couple Google searches brought us right to the cusomize keyboard section of the web. There we can enter the symbols and such that we want and volia! A keyboard with Solestic on it in place of English appears! Of course, you could always do it the cheap way and put little stickers on your current keyboard. But that just looks wierd.
sorry, but way up there I said you should do something roman. Obviously, I didn’t read the description of the blog until now
Ideas: I think you should do a long script of something, which could be from HG2G, or someother idea on this blog. But then you should do something everybody knows. Like the pledge of alegience. “I pledge alegience, to the flag, of the united states of America…”
That way, everybody knows it real well. Then if they really want to get into it, they can look at the other longer script.
(47) that was in ‘muse mail’ once.
Hasn’t that already been decided?
Administrator, It looks like, kokopelic’s #47 is like the most popular one with us Musefans. I think you should do it!!!!!!!
I agree it would be great. Unfortunately, She Who Must Not Be Named reports that they’ve just had to drop the Tho Fan translation from the issue–something about a problem with copyright permission. Sorry about that, but I guess I’d better close down the thread.